Regulation of adult skeletal muscle stem cell behaviour
Get perfect grades by consistently using www.customizedassignments.com. Place your order and get a quality paper today. Take advantage of our current 20% discount by using the coupon code GET20
Order a Similar Paper Order a Different Paper
theoretical investigation of the potential role of the gene sequence provided in adult skeletal muscle stem cell behaviour”
Save your time - order a paper!
Get your paper written from scratch within the tight deadline. Our service is a reliable solution to all your troubles. Place an order on any task and we will take care of it. You won’t have to worry about the quality and deadlines
Order Paper Nowprovided cDNA sequence: TCTAGGTCGACGGTNTCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCTCTATATGTTTTGATGGGGCTGCACATCATCTTGTCAGGTCCTGTCATTGAAAAGATGGCTCTCAGCTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTCCAATTCGCCCTATAGTGAGTCGTATTACGCGCGCTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGTTCTCGCTCGGATGAGCTTACCCGCCATATCCGCATCCACACAGGCCAGAAGCCCTTCCAGTGTCGAATCTGCATGCGTAACTTCAGTCGTAGTGACCACCTTACCACCCACATCCGCACCCACACNGGCGAGAAGCCTTTTGCCTGTGACATTTGTGGGAGGAAGTTTGCCAGGANTGATGANNGNAAGCCCTTCCCAACAGTTGCGCAGCCTGAATGGCGAATGGGACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTGGTTCGCGCAGCGTTGACCNNTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTTCGCNTTTCTTCCCTTCCTTTCTCGNCACGT
- Describes the aim of the project and summarizes the essence of the underlying hypothesis
- Describes strategy and methodology
- Describes relevant techniques and skillsdeveloped.
- Describes results and conclusion clearly
- Makes a connection of developed skill
- What is the sequence?
NB. Sometimes, the sequence contains more than one fragment that ligated together during the cloning procedure prior to sequencing
– Is the sequence ALL one transcript?
– Is there any genomic sequence?
- What is the structure of the transcript (introns/exons)
Is there more than one splice variant?
Is it part of a family?
- What is the protein product?
– Are there any functional domains?
– What do these domains do?
- What pathway(s)/functions does this gene product play a role in?
- What is known about the expression patterns of the gene (during development and in the adult)
